Introduction

Barley (Hordeum vulgare L.) is a valuable grain crop in all global cereal growing areas. It is used predominately for malting and for ruminant feed, whilst a small percentage is used for human consumption in low rainfall areas with poor fertility. Barley leaf rust, caused by Puccinia hordei, is one of the most destructive foliar diseases and has caused significant yield losses in many regions where barley is grown (Cotterill et al. 1992; Woldeab et al. 2007; Murray and Brennan 2009). Yield reductions of up to 32 % have been reported in certain susceptible barley cultivars in both Australia and North America (Park and Karakousis 2002). Due to the adverse environmental effect of fungicides, the most preferable and cost-effective means of controlling barley leaf rust is through the deployment of durable host resistance genes (Park 2008).

Two major types of resistance have been described for cereal rust pathogens, seedling/all-stage resistance (ASR) and adult plant resistance (APR). ASR genes are usually effective at all stages of crop development and are often characterised by hypersensitive reactions. Numerous ASR genes for resistance to P. hordei (Rph) have been identified (Rph1-Rph19, Golegaonkar et al. 2009; Rph21, Sandhu et al. 2012; Rph22, Johnson et al. 2013), but most have been rendered ineffective by mutational changes in P. hordei. In some regions including Australia, the presence of the alternate host Ornithogalum umbellatum (‘Star of Bethlehem’) can facilitate sexual recombination and increase the likelihood of new virulent pathotypes developing (Clifford 1985; Wallwork et al. 1992; Steffenson et al. 1993; Park 2003). APR in barley has been reported to provide incomplete resistance phenotypes that are often additive (Carlborg and Haley 2004; Golegaonkar et al. 2009; Singh et al. 2014 in press). Genes conferring resistance to leaf rust (P. triticina), stripe rust (P. striiformis f. sp. tritici) and stem rust (P. graminis f. sp. tritici) at adult plant growth stages are often additive and more durable (Singh 1992). Furthermore, some durable APR genes in wheat have been shown to be pleiotropic, providing effective resistance against multiple rust pathogens (i.e. Lr34/Yr18/Sr57, Lr46/Yr29/Sr58 and Lr67/Yr46/Sr55) (Singh 1992; Singh et al. 2000, 2011).

In previous studies, 13 quantitative trait loci (QTL) associated with partial leaf rust resistance to leaf rust (designated Rphq1 to Rphq13) were reported at both seedling and adult plant growth stages (Qi et al. 2000). A recent study also reported a total of 29 genomic regions that confer quantitative resistance to leaf rust in barley (Marcel et al. 2007). Among these QTL, 21 Rphq genes were identified and 19 were located on a high-density consensus map, including four loci effective only at the adult plant stage. Within barley, only two APR loci have been designated, however numerous other sources of APR have been identified although not yet characterized (Golegaonkar et al. 2009, 2010; Hickey et al. 2011; Singh et al. 2014 in press). Gene Rph20, originally from European descent, was sourced from the variety Pompadour and mapped to chromosome 5HS (Golegaonkar et al. 2009). A dominant marker has been developed from a DArT marker bPb0837 that maps 0.7 cM away from the Rph20 QTL (Liu et al. 2011). This marker has been found to be highly diagnostic for the presence of Rph20-derived APR resistance, but is not completely linked based on the presence of rare false positives (Hickey et al. 2011). Gene Rph23, which was found in the Australian barley variety ‘Yerong’, was recently designated and mapped to chromosome 7H (Singh et al. 2014 in press). A co-dominant SSR marker EBmac0603 was closely linked to the APR allele present in ‘Yerong’ (Singh et al. 2014 in press). Interestingly, Rph23 on its own displays a 60–70 moderately susceptible (MS) reaction in the field. However, when present with another minor QTL on chromosome 6HL (RphYer-6HL), the infection type decreases to 40–60 MRMS, indicating that these genes are additive (Singh et al. 2014 in press).

Diagnostic PCR-based markers for APR in barley facilitate screening of both advanced breeding lines and international germplasm collections to identify known APR genes for further genetic analysis and use. In this study, we used PCR-based markers linked to Rph20 and to Rph23 to screen a diverse set of international germplasm comprising lines carrying varying levels of APR based on the consensus of up to 3 years of phenotypic field data. We also report on the presence uncharacterised APR sources and discuss implications for barley germplasm improvement.

Materials and methods

Plant material

International barley germplasm (521 lines) was sourced from the Australian Winter Cereals Collection (AWCC) (92 lines), the University of Western Australia (UWA) (113 lines) and international collections from Australia (107 lines), China (20 lines), Germany (58 lines), Spain (80 lines), and Uruguay (20 lines).

Field assessment of APR to leaf rust in international germplasm

A total of 521 diverse international barley lines that were identified in previous studies (Golegaonkar et al. 2009; Sandhu 2011; Derevnina et al. 2013; Park pers. Comm.) to be seedling susceptible to P. hordei pt. 5457P + were assessed in field leaf rust nurseries either during 2011, 2012, 2013 or all 3 years at the Horse Unit field experimental site at the University of Sydney Plant Breeding Institute, Cobbitty (PBIC). Approximately 20–30 seeds of each line were sown in 0.7 m rows at 0.3 m spacing. The leaf rust susceptible barley genotype Gus was used in disease spreader rows sown after every five plots of test lines to assist uniform inoculum increase and spread across the experimental areas.

Pathogen isolates

Gene postulation was previously carried out on all lines using multipathotype testing (Derevnina et al. 2013; Sandhu 2011; Golegaonkar et al. 2009; Park pers. comm.). Pathotype designation was based on virulence/avirulence on the standard differential genotypes using the octal notation system (Gilmour 1973). The addition of ‘P+’ or ‘P-’ was used to indicate virulence or avirulence, respectively, on resistance gene Rph19, present in the cultivar ‘Prior’ (Park 2003). Field inoculations were carried out using pathotype 5457P + (accession number 090017), which is virulent on all postulated ASR genes previously found within the international germplasm screened in this study (Rph1, Rph2, Rph3, Rph4, Rph12 and Rph19) and Rph6, Rph9 and Rph10.

Inoculation procedures

Field inoculations were performed according to the technique outlined by McIntosh et al. (1995). Epidemics were produced in the field using a urediniospore–mineral oil suspension (30 mg of spores in 1.5 l of Isopar L mineral oil), which was misted over spreader rows using an ultra-low-volume applicator (Microfit; Micron sprayer Ltd. Bromyard, Herefordshire, UK). Four successive inoculations were carried out on afternoons when there was a high possibility of overnight dew.

Phenotypic analysis of field infection to barley leaf rust

A modified Cobb scale (Peterson et al. 1948) was used in the field to assess disease severity (percentage leaf area affected). Host response (R, no uredinia present; TR, trace or minute uredinia on leaves without sporulation; MR, small uredinia with slight sporulation; MR-MS, small-to-medium-sized uredinia with moderate sporulation; MS-S, medium-sized uredinia with moderate to heavy sporulation; S, large uredinia with abundant sporulation, uredinia often coalesced to form lesions) was assessed using scale outlined by Roelfs et al. (1992). Disease severity and host response were combined to represent field response for each line. The data on each line was collected either for 1, 2 or 3 years. Where lines were scored over multiple years, a range of lower and higher field response score was presented. Plants were scored when the susceptible check Gus reached 90–100S.

DNA extraction

Genomic DNA was extracted using the CTAB method (Fulton et al. 1995). The concentration and purity of each sample was measured using a NanoDrop 1000 Spectrophotometer (Thermoscientific, Scoresby, Victoria, Australia) and each sample was diluted to 50 ng μl−1 for PCR analysis as previously described by Singh et al. (2014) in press.

PCR marker screening analysis

All barley lines carrying APR used in this study were screened using markers bPb-0837 and Ebmac0603, which are linked to Rph20 and to Rph23, respectively. PCR analysis was performed for bPb-0837 as described by Hickey et al. (2011). Varieties Pompadour and Baronesse were used as positive controls for bPb-0837. Published primer pairs for Ebmac0603 were optimized to develop an assay permitting PCR–based genotypic screening for Rph23 (Singh et al. 2014 in press; Hayden et al. 2008). A 149-bp fragment containing 10 × CA dinucleotide repeats was amplified from a 10 μl reaction containing 40 μM dNTP, 10x Immolase Buffer (Bioline), 2.5 mM MgCl2, 1 μM of each primer (Ebmac0603F 5’ACCGAAACTAAATGAACTACTTCG3’; Ebmac0603R 5’TGCAAACTGTGCTATTAAGGG3’), 0.2U of Immolase Taq polymerase (Bioline), and approximately 40 ng of genomic DNA. The PCR conditions involved an initial denaturation step of 10 min at 95 °C followed by an initial cycle of 3 min at 94 °C, 1 min at 58 °C, 1 min at 72 °C and 30 cycles with the profile 30 s at 94 °C, 30 s at 56 °C, and 30 s at 72 °C. Different allele sizes were separated on a 2 % agarose gel against a 25 bp DNA ladder (Bioline) as described in Singh et al. (2014) in press.

Results

Adult plant resistance in international germplasm collections

A total of 521 seedling susceptible barley lines from diverse origin were screened for leaf rust field resistance at PBIC using the P. hordei pt. 5457P+. The 213 lines that consistently carried APR over multiple seasons are listed with their pedigree information in Table 1. On average, 41 % of lines across the collections carried APR and 80–90 % of these lines carried one or more uncharacterised APR genes either in the presence or absence of Rph20 or Rph23. The lowest frequency of APR was observed within Chinese germplasm, whilst over 50 % of both Spanish and Uruguayan lines carried APR (>90 % uncharacterised) and all were highly resistant in the field (TR-30MRMS) (Fig. 1). All 213 barley with APR were analyzed by different groupings based on factors such as the presence of uncharacterised APR, characterized plus uncharacterised APR genes, and geographic origin (Table 1).

Table 1 List of information (source, identifier name, pedigree information, field response and the presence of known and uncharacterised APR sourced based on marker data) for 213 barley lines that carried adult plant resistance in response to Puccinia hordei (pathotype 5457P+) from 2011 to 2013
Full size table
Fig. 1
figure 1

Graphical representation of the frequency of lines across all seven International germplasm collections that carried APR from both known (black) and uncharacterised (grey) sources when assessed across three separate field seasons with the P. hordei pathotype 5457P + for APR and screened with markers bPb-0837 and Ebmac0603 that are closely linked to Rph20 and Rph23 respectively

Full size image

APR gene postulation

Postulation of APR genes was performed by screening molecular markers bPb-0837 and Ebmac0603 linked to APR genes Rph20 and Rph23, respectively, across all 213 lines that carried APR compared to known field responses for both Rph20 (30-40MRMS) and Rph23 (60-70MS) respectively (Table 1). Approximately 48 % carried one of more uncharacterised APR gene and were negative for both bPb-0837 and Ebmac0603, 38 % were positive for bPb-0837, 12 % were positive for Ebmac0603 and 2 % carried both bPb-0837 and Ebmac0603 (Table 1, Fig. 2). In all cases, positive controls for bPb-0837 (Pompadour and Baronesse) and for Ebmac0603 (Yerong and Onslow) generated positive bands indicating the presence of their respective alleles (Table 1). Rarely were both bPb-0837 and Ebmac0603 found in combination, with the exceptions of German (Lenka, Line 17, and Volla) and Australian (Macquarie) lines that were all highly resistant (TR-20MR) under field conditions (Table 1). This suggests that both Rph20 and Rph23 are additive.

Fig. 2
figure 2

Graphical representation of the frequency of 213 APR lines within specific germplasm collections derived from Australia, AWCC, China, UWA, Germany, Spain and Uruguay that carry varying levels of APR [low-MS-S (grey), medium-MRMS (light grey) and high-TR-20MR (black)]

Full size image

The APR response was classified into three groups: (High <20MR, Moderate 20MRMS - 50MS, and Low 50MS - 70MSS). Across the 213 lines with APR, 137 (64 %) were TR-20MR but many were negative for either the bPb-0837 or Ebmac0603 markers (Table 1). This suggests that there must also be uncharacterized additive APR genes present in much of the germplasm tested. From a total of 51 (23 %) lines that were rated MRMS, only a relatively small proportion carried bPb-0837 (7, 14 %) or Ebmac0603 (6, 12 %) markers. The remaining 27 (12 %) lines carried low levels of APR, three of which were positive for Ebmac0603 and likely carried Rph23 only (Table 1).

The frequency of Rph20 and Rph23 in international germplasm collections

Both bPb-0837 and Ebmac0603 marker alleles were present in five out of the seven (71 %) germplasm collections tested (Fig. 2). The highest frequency of Ebmac0603 was 20 % within Chinese lines and 18 % in Spanish lines, while the bPb-0837 allele was not present within any of the Chinese or Spanish germplasm tested, but was found at high frequencies within German, Uruguayan, Australian, UWA, and AWCC breeding lines (Table 1).

There was significant variation between Australian lines in terms of their APR. A smaller frequency of lines were TR-20MR, while this collection had the highest frequency of MS lines. All lines but one that carried Rph23 were MS to S, suggesting that they carry only Rph23. Macquarie was positive for both Rph20 and Rph23 markers and was TR, which may indicate a third APR gene yet to be characterised (Table 1). The majority of genotypes (76 %) within the AWCC breeding collection were TR-MR and this was likely to be attributed to the presence of the Rph20 (bPb-0837 marker allele at high frequencies) (Table 1, Fig. 3). From a total of 37 genotypes, 32 (86 %) had very high levels of APR and of these, 23 (62 %) were postulated to carried Rph20 and none carried Rph23 based on the presence of both markers suggesting there may be some uncharacterized APRs in these lines (Fig. 3). Furthermore, many of the lines were scored as TR suggesting the presence of additive genes other than Rph20 that are yet to be characterized. Lines within the UWA collection were mostly TR-20MR which was largely attributed to the presence of Rph20 and to a lesser extent Rph23. Two lines in particular contained Rph23 and had low APR, whilst there were many lines with high APR that contained neither known APR gene (Table 1, Fig. 3).

Fig. 3
figure 3

Graphical representation of the frequency of 213 APR lines that carried neither bPb-0837 or Ebmac0603 alleles, bPb-0837 allele only, Ebmac0603 allele only or both bPb-0837 and Ebmac0603 alleles. Shading denotes the proportion of lines that are postulated to carry only known APR (Rph20 or Rph23) (black) and unknown APR (grey)

Full size image

A total of 20 and 44 lines from Germany, and Spain, respectively, formed the European collection. Most German lines were rated TR-20MR and this correlated strongly with the presence of bPb-0837, which was more frequent (70 %) in German lines than in any other collection. Volla (0-1R), Lenka (TR-15MR), and Line 17 (5MR-20MR) displayed positive bands that supported the presence of both Rph20 and Rph23. Interestingly, most (70 %) Spanish lines tested were also TR-20MR, but there was no evidence of Rph20 in any of these lines. Ebmac0603 was present in eight lines (18 %), all of which were TR-20MR. These lines, in addition to most lines in the Spanish collection, contain at least one or more uncharacterized APR genes (Table 1, Fig. 3).

Lines from two separate and geographically diverse barley-growing locations (China and Uruguay), all carried varying levels of APR. Uruguayan lines had high levels of APR, which correlated strongly with the presence of bPb-0837. The bPb-0837 allele was not found in any of the lines originating from China, and the Chinese collection had no lines with high APR. Ebmac0603 was present at relatively high frequencies within the Chinese germplasm and absent from Uruguayan lines (Table 1, Fig. 3).

Discussion

The objective of this study was to characterize and provide a comprehensive understanding of the diversity of APR within international germplasm collections from the major barley regions of the world. We assessed 521 seedling susceptible barley genotypes derived from elite breeding material, landraces, and germplasm collections for APR over multiple field seasons using a highly virulent pathotype of P. hordei (5457P+) . Those lines (213) that carried APR were subsequently screened for the presence of known genes (Rph20 and Rph23) based on marker assays. This marker data and disease rating for each line was then compared to known field infection types expected for the presence of Rph20 and Rph23 alone to postulate the likely presence of known and uncharacterised APR. Varying levels of APR were found based on 3 years of phenotypic data from field tests, with any differences in disease severity across years being attributed to environmental factors and /or growth stages at the time of disease scoring. Previous studies on the expression of APR to leaf rust in both wheat (Lr34) and barley (Rph20) suggest that these genes are most effective at cooler temperatures (Singh et al. 1998, 2013). This could also account for variation of APR observed over different growing seasons, especially within Australian lines in this study.

The APR response within international germplasm collections was associated with the presence of Rph20, and to a lesser extent to the presence of Rph23. Lines that were positive for bPb-0837 almost always had high levels of APR. Lines that carried Rph23 as determined by marker EBmac0603, showed greater variation in their APR response, which can be explained by the MS to S field reaction contributed by this gene. Previous reports found Rph20 provided moderate protection (20MR - 40MS) and Rph23 provided low (60MS - 70MS) protection, respectively (Derevnina et al. 2013; Sandhu 2011; Golegaonkar et al. 2009; Singh et al. 2014 in press). The presence of Ebmac0603 within Chinese and especially Australian lines was correlated with low APR in the field across multiple test years. Lines with low levels of APR (60-70MSS) that were positive for the Rph23 marker allele may represent single gene lines that can be used for further genetic analysis and selection of Rph23 for varietal improvement. Recent genetic studies of Rph23 from the Australian barley cultivar Yerong suggests that it is a highly additive gene (Singh et al. 2014 in press). Future characterization and molecular marker development for newly identified additive APR sources will enable breeders to pyramid such resistance.

The additively of uncharacterised APR genes with either Rph20 or Rph23 resulted in lines that showed TR-20MR responses in the field. Additionally, there were many lines showing high APR in this study that lack the markers linked to Rph20 and Rph23. These lines likely carry other uncharacterized APR genes that may provide more protection in the field than either Rph20 or Rph23, as none carried any seedling resistance that is effective against the P. hordei 5457P + pathotype. Further genetic analysis and characterization of such uncharacterised APR is required for marker development and varietal improvement.

There was no relationship between geographic location and the presence of known APR genes. However, in some cases the presence of particular APR and ASR genes appeared to be associated with human-mediated movement of germplasm. The Rph20 marker bPb-0837 was present at almost equal frequencies within collections from Uruguay and Germany. Interestingly, previous studies determined that lines from both these countries carried the ASR gene Rph3, and none of the lines carried Rph23. Historical evidence suggests that two German scientists established the first barley breeding program in Uruguay (Newman and Newman 2008). It is possible that some of the lines derived from both collections may share the same or similar pedigrees, but there was no information available on pedigrees derived from Uruguay. Additionally, bPb-0837 was not present within any of the Spanish barley lines, which is somewhat unusual given the previously reported European origin of this APR gene (Hickey et al. 2011, 2012). One likely explanation is that the Spanish lines tested in this study were all landraces, which may pre-date intercrossing of cultivated barley with Hordeum laevigatum reported to be the original source of Rph20, in cultivated barley (Hickey et al. 2012).

It was not possible to pinpoint the ancestry of all Rph23-positive lines detected in this study because apart from the Australian lines investigated, pedigree information is not available. The pedigrees of Australian lines that were positive for Ebmac0603 were highly related. Singh et al. (2014) in press predicted variety Lion (C.I. 923; a selection from black six-rowed barley from Taganrog) as a likely progenitor of Rph23 in Australian barleys including lines that were positive for Ebmac0603 in this study. Lion was introduced into Australian barley germplasm via Forrest through Onslow. Forrest (C.I. 9187) is a North America barley released in the 1940s from the original cross Newal/Peatland. Lion and Forrest are genetically related through Newal. The Australian variety Beecher (positive for Ebmac0603) and one of the parents (Glacier) of the North American line Glacier/Titan (a sib of variety Unitan; also positive for Rph23 marker) are both derived from the same cross, Atlas/Vaughn. Vaughn was used widely in North American breeding programs for high yield. Interestingly, Vaughn is derived from the cross Lion/Club Mariout, which further suggests that Lion is the likely progenitor of Rph23 in Australian and North American barleys.

In summary, here we report on APR gene postulation and the discovery of numerous new APR sources within seven international germplasm collections based on screening with markers closely linked to known APR genes Rph20 and Rph23. Markers bPb0837 and Ebmac0603 were highly diagnostic for the presence of Rph20 and Rph23 and illustrates their suitability for MAS. This study also identified a large diversity in APR response and the likely combination of both known and uncharacterised APR genes within germplasm collections that can be further implemented within barley breeding programs. Further research is required to identify single gene donors of each uncharacterised APR source for trait dissection and marker development to pyramid multiple APR sources into barley varieties to achieve durable resistance. Further characterization of unknown APR genes and marker development will be important in future efforts to develop cultivars with durable resistance to P. hordei.