Introduction

The distribution of tick species and the associated risk of tick-borne infections are influenced by their preference for peculiar ecological environments (Parola and Raoult 2001). By adapting to the movement of animals and bird migration, ticks proliferate and colonize a region (Madder et al. 2011). Worldwide, and especially in Sub-Saharan Africa, tick-borne pathogens are the cause of many emerging infectious diseases (Dunster et al. 2002; Parola et al. 2005). Ticks are efficient in the transmission of various pathogens that affect both man and animals (Casati et al. 2006; AL-Hosary et al. 2018). Moreover, tick-borne diseases constitute a serious animal disease problem in Africa (Young et al. 1988), particularly among small-scale farmers in Central, East and Southern Africa (Jongejan and Uilenberg 2004). West Africa is no exception as tick-borne pathogens of medical and veterinary importance have been detected in Nigeria (Lorusso et al. 2016), Ghana (Bell-Sakyi et al. 1996; Akuffo et al. 2016; Paintsil et al. 2022), Burkina Faso (Moumouni et al. 2022), Benin (Ouedraogo et al. 2021) d te d’Ivoire (Ehounoud et al. 2016; Adjogoua et al. 2021).

Rickettsial infections continue to spread to non-endemic regions with tick bites as the primary route of transmission (Parola et al. 2013). Reports from countries including Burkina Faso and Côte d’Ivoire indicate that human exposure occurs at a seroprevalence rate of 17–36% (Mediannikov et al. 2010a; Parola et al. 2001). It is common to find rickettsial infections in travelers returning from endemic zones (Leshem et al. 2011). Rickettsia africae, the agent of African tick-bite fever, is transmitted by Amblyomma hebraeum or Amblyomma variegatum depending on geographical location (Parola et al. 2005). However, Rickettsia aeschlimannii has been isolated from Hyalomma marginatum in Algeria (Bitam et al. 2006), Egypt (Abdel-Shafy et al. 2012; Kernif et al. 2012) and Morocco (Sarih et al. 2008). Various tick species have been reported to harbor Rickettsia due to co-feeding (Mediannikov et al. 2012).

Coxiella burnetii is a bacterium that causes Q fever in humans (Gangoliya et al. 2019; Gondard et al. 2017). Apart from ruminants serving as the primary source of infection for man, wild animals, dogs and cats can be potential sources of infection (Dalton et al. 2014). Coxiella burnetii is transmitted through inhaling contaminated aerosol (Hogerwerf et al. 2012; Leski et al. 2011), consuming contaminated milk (Bell and Beck 1950; Hermans et al. 2011) and contact with infected tissues or tick faeces (Delsing et al. 2010). Although ticks harbour and transmit C. burnetii to animals, there is scarce information to support their role in transmission to humans (Eklund et al. 1947; Loukaides et al. 2006; Nett et al. 2012; Rolain et al. 2005). Even though animals such as goats and sheep are asymptomatic when infected with C. burnetii (De Cremoux et al. 2012), abortions can occur in pregnant animals as well as low birth weight in offspring (Stoker and Marmion 1955).

In Ghana, ticks have been identified to harbor pathogens including Rickettsia spp. and C. burnetii (Paintsil et al. 2022). This indicates the importance of ticks in the country and their significant influence on animal and human health. In the Upper East Region of Ghana, most inhabitants rear livestock for food and income. However, these animals may be amplifying hosts for infectious zoonotic pathogens, putting owners at a considerable risk of infection (Al-Tayib 2019). Movement of livestock from countries, including Burkina Faso, into Ghana could facilitate the introduction of exotic tick species as well as tick-borne pathogens. It is crucial to adopt effective control measures to reduce the burden and spread of tick-borne infections. This study sought to assess the prevalence of Rickettsia species and C. burnetii in ixodid ticks infesting livestock in Kassena-Nankana of Northern Ghana. The findings from this study will be an addition to the limited information on tick-borne pathogens in Ghana and the veterinary and public health implications.

Methods

Study site and tick collection

The study area included sites within Kassena-Nankana of the Upper East Region (Fig. 1). Kassena-Nankana has been divided into Kassena-Nankana Municipal (formerly Kassena-Nankana East) and Kassena-Nankana West District. The vegetation of the study area is Guinea Savannah with two seasons; a dry season that occurs from November to April and a wet season that spans from May to October. Residents of the district are largely into agriculture (Mensah and Fosu-Mensah 2020). Between February and December 2020, ticks were collected from randomly selected livestock (cattle, sheep and goats) in the dry and wet seasons. Each animal was restrained and ticks were removed using blunt forceps. The collected ticks were sorted out based on the host, kept in well-labelled 15-mL Eppendorf tubes containing RNALater and transported to Noguchi Memorial Institute for Medical Research. In the laboratory, the ticks were identified using morphological keys (Walker et al. 2003).

Fig. 1
figure 1

Map indicating the study sites in Kassena-Nankana Districts, Ghana

Full size image

Nucleic acid extraction and detection of pathogens

The tick samples were pooled (1–10), with each pool made up of ticks of the same sex, and species and from the same animal host. Total nucleic acid was extracted from each pool using QIAamp Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions (Crowder et al. 2010).

The tick pools were screened for the presence of C. burnetii DNA using a real-time polymerase chain reaction (RT-PCR) assay that targets the 295-bp fragment of the transposase gene of C. burnetii IS1111a element (Klee et al. 2006). The primers used were Cox-F (CCCCGAATCTCATTGATCAGC), Cox-R (CCCCGAATCTCATTGATCAGC) and probe Cox-TM (FAM-AGCGAACCATTGGTATCGGACGTT-TAMRA-TATGG). The PCR run was performed in a 7300 RT-PCR System (Applied Biosystems, Waltham, MA, USA) per the cycling conditions: initial hold at 50 °C for 2 min, a second hold at 95 °C for 10 min and a third hold at 40 cycles for 95 °C for 15 s and 60 °C for 30 s.

Furthermore, Rickettsia DNA was detected in tick pools using primers R17k128F (GGGCGGTATGAAYAAACAAG), R17k238R (CCTACACCTACTCCVACAAG) and probe R17k202TaqP (FAM-CCGAATTGAGAACCAAGTAATGC-TAMRA) in a quantitative PCR (qPCR) which targets the 115 bp fragment of the 17 kDa surface protein of Rickettsia species (Jiang et al. 2004). The PCR was run using a 7300 RT-PCR System (Applied Biosystems) based on the cycling conditions: 1 cycle at 95 °C for 2 min, followed by 45 cycles at 95 °C for 5 s and 60 °C for 30 s (fluorescence read and data acquisition) and finally 1 cycle at 40 °C for 30 s.

The samples that were Rickettsia genus positive were subsequently characterized using primers 190-70 F (ATGGCGAATATTTCTCCAAAA) and 190-701R (GTTCCGTTAATGGCAGCATCT) that target the rOmpA gene (ompA) of Rickettsia amplifying at 632 bp (Jiang et al. 2005). Amplification was performed in a Mastercycler X50-PCR thermocycler (Eppendorf, Germany) according to the cycling conditions: initial hold at 95 °C for 5 min, followed by a second hold at 34 cycles at 95 °C for 30 s, 51.5 °C for 30 s and 72 °C for 1 min and finally a third hold at 72 °C for 5 min, followed by a hold at 4 °C. The PCR product was run on a 2% agarose gel for about 1 h and 30 min.

The positive PCR products were subsequently shipped to a commercial facility (Macrogen Europe, Amsterdam, The Netherlands) for sequencing.

Phylogenetic analysis

Nucleotide sequences obtained in this study were cleaned, edited and compared to other sequences included in the NCBI database as well as reference sequences (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The Clustal Omega tool in MEGA X was used to align the sequences and phylogenetic trees constructed using the neighbor-joining method (Kumar et al. 2018). The countries of origin and accession numbers of all the GenBank sequences used in the analysis are shown in the phylogenetic tree.

Statistical analysis

STATA v.13 was used to analyze the data. The χ2 test was used to determine the association between pooled tick infection status and livestock characteristics. A univariate generalized negative binomial mixed effect model was used to determine the association between the tick burden with animal characteristics and season. Pool Screen software was used to estimate the infection rates in the various tick species (Katholi and Unnasch 2006). The significance level was set at α = 0.05.

Results

From the 448 livestock screened, tick infestations were 54.2% in cattle, 26.8% in sheep and 19.0% in goats (Table 1). In total, 1550 ticks, made up of 1247 adults and 303 nymphs, were collected from the examined livestock. More adult ticks were collected in the wet season than in the dry season. There was no significant association between adult ticks and characteristics such as animal host, sex, age and body part. Furthermore, more nymphs were collected from the male animals and most were attached to the scrotum (Table 1).

Table 1 Prevalence and distribution of tick life stages sampled from livestock
Full size table

Tick species composition

Ticks of the genera Amblyomma (n = 976), Hyalomma (n = 290) and Rhipicephalus (n = 284) were identified in this study. The predominant species was A. variegatum (63.0%) with the least occurring tick species being Rhipicephalus sanguineus (s.l.) (0.06%) (Fig. 2). Adult A. variegatum occurred mostly in the wet season compared to the dry season (Table 2).

Fig. 2
figure 2

Tick species sampled in Kassena-Nankana Districts, Ghana

Full size image
Table 2 Seasonal abundance of tick species in Kassena-Nankana Districts, Ghana
Full size table

Tick-borne pathogens DNA detected

Out of the 491 tick pools screened, an overall Rickettsia species positive rate of 56.8% was recorded (Table 3). Amblyomma variegatum had the highest positive pools for Rickettsia spp. DNA with an infection rate of 28.3% [95% confidence interval (95% CI) 24.38–32.51]. Coxiella burnetii DNA was detected in 3.7% of the tick pools examined (Table 3). Additionally, Rhipicephalus evertsi evertsi recorded the highest C. burnetii infection rate of 3.9% (95% CI 1.48–8.09). An overall coinfection of 2.4% was observed in the tick pools (Table 3).

Table 3 Prevalence of Rickettsia spp. and Coxiella burnetii in sampled tick species from Kassena-Nankana Districts, Ghana
Full size table

The screened tick pools indicated a significant association between Rickettsia, Coxiella and season of tick collection with most R. africae and C. burnetii DNA detected in the wet season samples whereas R. aeschlimannii occurred mostly in the dry season samples (Table 4). All the above-mentioned pathogens were identified mostly in ticks collected from cattle. The DNA of C. burnetii was identified mostly in ticks collected from female animals whereas the DNA of R. aeschlimannii was detected in ticks collected from animals older than 3 years. A significant association was also observed for R. aeschlimannii, C. burnetii and the tick developmental stage with DNA of the latter detected only in adult ticks (Table 4).

Table 4 Association of tick-borne pathogens in the sampled ticks
Full size table

Characterization of Rickettsia species

Two Rickettsia species were identified, R. africae (39.7%) and R. aeschlimannii (14.7%). The Rickettsia sequences in this study were 100% similar to sequences from Benin (acc. nrs. KT633262 and KT633264), Spain (MW398876) and China (MH932058). Rickettsia africae was identified in A. variegatum (38.7%) and R. evertsi evertsi (1.0%). Rickettsia aeschlimannii was identified in A. variegatum (1.0%), H. rufipes (11.4%) and H. truncatum (2.2%).

With bootstrap support of 85%, it was observed from the phylogenetic analysis that the R. africae samples from this study clustered with R. africae from Burkina Faso (acc. nr. KX063619) (Fig. 3). Furthermore, R. aeschlimannii from this study clustered with R. aeschlimannii from Ethiopia (acc. nr. KX063618) and Burkina Faso (acc. nr. KX063617) with bootstrap support of 99%.

Fig. 3
figure 3

Phylogenetic analysis of Rickettsia species based on the rOmpA gene. The sequences from this study have been highlighted. The sequences were aligned in MEGA X and phylogenetic trees were built using the neighbor-joining method with 1000 bootstrap replications

Full size image

The sequences obtained in this study have been deposited in GenBank: R africae (acc. nrs. OQ331037 and OQ331038) and R. aeschlimannii (OQ331039 and OQ331040).

Discussion

Ticks and tick-borne pathogens have recently emerged as one of the major public health concerns globally. Amblyomma variegatum, the most common type of tick identified in this study, infested predominantly cattle in both the wet and dry seasons. Furthermore, adult A. variegatum was more common during the wet season with nymphs of the same species occurring only during the dry season. This finding collaborates with other studies which reported that adult A. variegatum feeds largely in the rainy season as opposed to the nymphs which feed mostly in the dry season (Spickler 2009).

In this study, Rickettsia spp. and C. burnetii were identified in all three genera of ticks examined. Furthermore, coinfections were observed in tick pools. It is common to find coinfections in ticks that feed on a co-infected host (Levin and Fish 2000, 2001). The finding in this study can be compared to previous studies that found mixed infections of Rickettsia spp. and C. burnetii in ticks in Nigeria (Reye et al. 2012) and Ghana (Paintsil et al. 2022).

Rickettsia species are considered to be among the oldest known cause of zoonotic vector-borne diseases (Parola et al. 2013). In Africa, R. africae which causes African tick-borne fever is the most predominant Rickettsia species (Kelly et al. 1996). In Sub-Saharan African countries like Senegal and Cameroon, studies have revealed a significant seroprevalence of R. africae in humans (Ndip et al. 2004; Mediannikov et al. 2010a). Apart from the principal vectors A. variegatum and A. hebraeum (Parola 2006; Parola et al. 2013), R. africae has been reported in tick species of the genera Rhipicephalus and Hyalomma from Nigeria, Liberia, Guinea, and Senegal (Mediannikov et al. 2010a, 2012; Ogo et al. 2012; Reye et al. 2012).

The high occurrence of Rickettsia DNA in A. variegatum is similar to a previous study in Ghana (Paintsil et al. 2022). Further characterization of the Rickettsia spp. revealed a high occurrence of R. africae DNA in A. variegatum similar to the report of studies conducted in Côte d’Ivoire, Guinea and Liberia (Mediannikov et al. 2012). This finding could be due to the transstadial and transovarial transmission of R. africae in A. variegatum (Socolovschi et al. 2009). Other African countries that reported DNA of R. africae in A. variegatum include Nigeria, Uganda (Lorusso et al. 2013), Burkina Faso (Tomassone et al. 2016) and Benin (Moumouni et al. 2016). With the difficulties associated with the accurate diagnosis of most febrile illnesses, there is the possibility of unreported cases of tick-bite fever within the country (Ahorlu et al. 1997; Dalrymple et al. 2017). Furthermore, African tick bite fever (ATBF) infections within the Kassena-Nankana Districts are more likely to occur in the wet season when the principal vector A. variegatum is abundant and there are high chances of contact with humans that are engaged in agricultural activities.

Rickettsia aeschlimannii DNA was also found in the ticks examined in this study. This bacterium has been reported in ticks collected from Burkina Faso (Tomassone et al. 2016), Nigeria (Kamani et al. 2015), Senegal (Mediannikov et al. 2010a)d te d’Ivoire (Ehounoud et al. 2016). The first case of R. aeschlimannii infection was reported in a patient who had visited from Morocco (Raoult et al. 2002). The pathogen has since been discovered in H. marginatum, H. rufipes and H. truncatum from Tunisia, Mali, Nigeria, Niger, Algeria, Senegal, Sudan and Egypt (Parola et al. 2001, 2005; Kernif et al. 2012; Mediannikov et al. 2010a; Kamani et al. 2015). Similarly, this study identified R. aeschlimannii in pools of H. rufipes, H. truncatum and A. variegatum. The results from this study suggest that several Rickettsia spp. are present in ticks in Ghana. Thus, necessitating the need for their proper identification to assess their veterinary and public health implications and to develop effective management methods. This is especially important because the DNA of Rickettsia spp. was detected in ticks that were collected from cattle imported from Burkina Faso to be marketed in the Kassena-Nankana Districts.

Coxiella burnetii causes severe infections that can lead to abortion and chronic endocarditis (Kazar 2005; Maurin and Raoult 1999). Domestic animals such as sheep, cattle, goats, and dogs can be a source of infection to humans through direct contact (Cooper et al. 2011). Coxiella burnetii has been detected in ticks belonging to the genera Dermacentor, Amblyomma and Rhipicephalus (Parola and Raoult 2001). Infections in ticks have been reported in West Africa at rates ranging from 0.7 to 6.8%. (Mediannikov et al. 2010b). This is in line with the findings of this study, which found 2.4% of ticks to harbor the DNA of C. burnetii.

Infections of C. burnetii were found in A. variegatum, Hyalomma spp. and Rhipicephalus spp. in Senegal, suggesting that they may play a role in Q fever epidemiology (Mediannikov et al. 2010b). In the Kassena-Nankana Districts, these tick species were also found to harbor the DNA of C. burnetii. Thus, these tick species may play a role in the epidemiology of C. burnetii in the study area. The DNA of C. burnetii was most prevalent in R. evertsi evertsi collected from sheep and screened in this study. Although small ruminant infections are normally asymptomatic, abortions and stillbirths can occur, particularly in late pregnancy (Van den Brom et al. 2015).

Infected animals can spread C. burnetii through their feces, milk, and most crucially, placental tissues and birth fluids (Maurin et al. 1999; Bouvery et al. 2003). As an emerging zoonosis, sheep and goats are linked to several human Q fever outbreaks (Van den Brom et al. 2015). The detection of C. burnetii DNA in ticks collected from sheep and goats in this study is in consonance with the results of previous research in Ghana (Johnson et al. 2019; Folitse et al. 2020; Paintsil et al. 2022). An increase in trade and sales of livestock across Ghana will likely increase the risk of C. burnetii transmission to naive animals and humans.

The use of insect repellents and protective garments have been found to lower the likelihood of tick bites and, as a result, the transmission of pathogens (Rahlenbeck et al. 2016). Education, the intake of only pasteurized milk and milk products, and the wearing of protective clothes, particularly when working with animals, are other ways to prevent infections (Honarmand 2012).

Conclusion

This study reports the prevalence of ixodid ticks infesting livestock in the Kassena-Nankana Districts of Ghana and the presence of the DNA of R. africae, R. aeschlimannii and C. burnetii. These findings are of veterinary and public health significance considering the involvement of the human population in livestock-related activities. There is an increased risk of ticks and zoonotic tick-borne pathogens being imported into Ghana due to the transboundary movement of herders and their livestock from numerous African countries. Thus, there is a need for further research to update the information on the status of ticks and zoonotic tick-borne pathogens in Ghana for the formulation of effective control measures.