Fungal viruses are prevalent in various fungi, including yeasts, mushrooms, and pathogenic fungi that infect plants, insects, and humans [1,2,3]. In 1948, the first fungal virus was found in the edible fungus Agaricus bisporus [4]. Examples of other fungal viruses reported in other mushroom species include mushroom bacilliform virus (MBV) and mushroom virus X (MVX), found in A. bisporus [5,6,7], Lentinula edodes spherical virus, found in Lentinula edodes [8], and Flammulina velutipes browning virus (FvBV), found in Flammulina filiformis [9, 10].

Viral metagenomics is a new virus detection method based on the rapid development of high-throughput sequencing technology. The genomes of fungal viruses are double-stranded RNA (dsRNA), positive-sense single-stranded RNA (+ssRNA), negative-sense single-stranded RNA (−ssRNA), or single-stranded DNA (ssDNA) [10,11,12,13,14,15]. The genomes of ssRNA and dsRNA viruses have been reported in edible mushrooms [16], but negative-stranded RNA viruses are rarely reported [17]. Mymonaviridae is a family of negative-strand mycoviruses belonging to the order Mononegavirales [18]. In general, viruses of the family Mymonaviridae have a linear single-segment RNA genome of about 10 kb, and the host range mainly includes fungi [18, 19]. The genome has no poly(A) tail structure at the 3' end, and the virions are filamentous enveloped particles with a diameter of 25–50 nm and a length of about 1,000 nm [18, 19].

Auricularia heimuer is widely cultivated in China and used as a dietary supplement due to its medicinal properties. However, the effect of viral infections on the quality and yield of this fungus has not yet been investigated. In this study, strains of A. heimuer collected from local factories were subjected to RNA sequencing and found to be infected with a virus, which was shown by phylogenetic analysis to be a new member of the family Mymonaviridae. This is the first negative-strand RNA virus and the third virus discovered in A. heimuer [20, 21].

A. heimuer strain CCMJ1222 was collected from the Engineering Research Center of Edible and Medicinal Fungi, Ministry of Education, Jilin Agricultural University. The strain was cultured on potato dextrose agar for seven days in the dark at 25℃. Fungal total RNA was extracted using an RNAiso Kit according to the manufacturer's instructions (Takara, Dalian, China). The total RNA samples were treated with DNase I (Takara, Dalian, China), and their integrity was evaluated by agarose gel electrophoresis and spectrophotometry using a NanoDrop 1000 instrument (Thermo Scientific, Wilmington, DE, USA). Library construction and deep sequencing were performed by Novogene Bioinformatics Technology Co., Ltd. (Beijing, China).

After deep sequencing, adapter sequences and low-quality reads were removed from the raw reads of each library using Trimmomatic (version 0.36) [22]. The clean reads were mapped to the A. heimuer genome [23] using HISAT2 (version 2.1.0) [24]. The unmapped reads were assembled using Trinity (version 2.5.0) by de novo assembly [25]. The assembled contigs were compared to the NCBI nonredundant protein database using BLASTn and BLASTX (with significant e-value ≤ 1e−5) to identify virus-related contigs. The virus-related contigs that matched to the same reference sequence were merged into longer contigs using DNAMAN software (version 8.0; Lynnon Biosoft, Quebec, Canada).

Specific primers were designed based on the virus-related contigs and used for RT-PCR assays to identify viral sequences in the A. heimuer strains. First-strand cDNA was synthesized using a cDNA Synthesis SuperMix kit (TransGen, Beijing, China), using total RNA from A. heimuer obtained previously as a template. The 18S rRNA gene was used as an internal reference gene to analyze the synthesized cDNA [26]. Based on the verified sequences, we identified a novel virus, which we named “Auricularia heimuer negative-stranded RNA virus 1 DW” (AhNsRV1-DW). AhNsRV1-DW-specific primers were used to identify the target strain by PCR (Supplementary Table S1).

To verify the integrity of the virus genome, nested PCR was carried out with multiple sets of overlapping primers using the RACE method [26,27,28,29]. PCR products were separated by agarose gel electrophoresis, recovered using a Gel Extraction Kit (Axygen, NY, USA), and cloned into the vector pMD18-T (TaKaRa, Dalian, China). The primer pair M13-47/M13-48 (CGCCAGGGTTTTCCCAGTCACGAC/AGCGGATAACAATTTCACACAGGA) and specific primers were used for PCR detection of cloned sequences in bacteria cultured in liquid medium (Supplementary Table S1). The liquid culture medium containing the target bacteria was sent to Wuhan Quintarabio Biotechnology Co., Ltd. for sequencing. Each sample was sequenced three times to obtain high-quality sequences and avoid false-positive PCR results. Finally, the full-length cDNA sequence of the virus in A. heimuer strain CCMJ1222 was obtained through SnapGene splicing.

Based on the whole genome sequence, 3–4 specific primers were designed using the NCBI online software Primer Blast to verify the accuracy of the full-length sequence, and the RACE method was used to verify the terminal sequences. KOD high-fidelity enzyme was used for amplification. The PCR reaction was performed according to the instruction manual. A pTOPO-Blunt Kit (Aidlab, Beijing, China) was used for blunt-end cloning according to the kit instructions.

Conserved domains in AhNsRV1 were identified using the online software MOTIF (https://www.genome.jp/tools/motif/. The BLAST program at NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to search for homologous sequences. A phylogenetic tree was constructed by the maximum-likelihood method. An amino acid sequence alignment was performed using MAFFT and ClustalX software [30, 31], and the phylogenetic tree was visualized and edited using MEGA X.

The genome of AhNsRV1 is 11,441 nt in length and has a GC content of 59.5%. The genome contains six ORFs with no overlaps (Fig. 1A). There is no cap structure at the 5′ end and no poly(A) structure at the 3′ end. The virus contains a 5′ UTR of 57 nt and a 3′ UTR of 296 nt. The 3'-UTR and 5′-UTR sequences had obvious complementary characteristics and were similar sequences (Fig. 1B). The genome structure of AhNsRV1 is similar to that reported for Lentinula edodes negative-stranded RNA virus 1 (LeNsRV1) [17] of the family Mymonaviridae (Fig. 1A). The spacer region has a series of conserved sequence elements rich in A/U (Fig. 1C). The largest ORF in AhNsRV1 is ORF VI. ORF VI is 5,908 nt long and encodes a putative L protein (RNA-dependent RNA polymerase [RdRP]) with 30.61% sequence identity to the RdRp of a virus from Golovinomyces cichoracearum. The L protein has 1,969 amino acid residues with a calculated molecular weight of 220.59 kDa and an isoelectric point of 6.64. The protein contains the conserved motif GxxTx (n) HR, which plays a key role in forming the mRNA cap structure [32, 33]. The other ORFs encode hypothetical proteins for which no homologs were found in the NCBI database. A BLAST search showed that the nucleotide sequence of the AhNsRV1 genome is 36.62% identical to that of Bondarzewia berkeleyi negative-strand RNA virus 1 and 34.94% identical to that of Armillaria mellea negative-strand RNA virus 1. The virus has been deposited in GenBank with the accession number MT259204.

Fig. 1
figure 1

Structure and characteristics of the AhNsRV1 genome. (A) Comparison of the size and structure of the AhNsRV1 and LeNsRV1 genomes. (B) The 3′ UTR and 5′ UTR reverse complementary sequences of AhNsRV1 are very similar to each other, and identical amino acids are highlighted in yellow. (C) Multiple alignment of the sequence of the intergenic regions. The sequence direction is 3′–5′

Full size image

Twelve representative viruses belonging to four families of the order Mononegavirales were selected for multiple alignment of their RdRp sequences, which revealed the presence of eight conserved motifs (Supplementary Fig. S1). Phylogenetic analysis based on this alignment showed that AhNsRV1 and some members of the family Mymonaviridae clustered into a single branch of the phylogenetic tree (Fig. 2). In terms of genomic structure, AhNsRV1 is similar to Lentinus edodes negative-strand virus 1 (LeNsRV1) of the family Mymonaviridae, which infects the edible fungus Lentinus edodes. Therefore, AhNsRV1 is a new member of the family Mymonaviridae. Based on our analysis, we suggest the assignment of AhNsRV1 to the genus Auricularimonavirus in the family Mymonaviridae [18].

Fig. 2
figure 2

RAxML phylogenetic tree constructed based on amino acid sequences of the conserved domain of RdRp of AhNsRV1 and members of four families of the order Mononegavirales. The position of AhNsRV1 is shown in red

Full size image

In this study, we isolated a novel mycovirus with a single-stranded negative-strand RNA genome from A. heimuer strain CCMJ1222. To the best of our knowledge, this is the first report of a negative-stranded RNA virus in A. heimuer. This study provides new information about negative-stranded RNA viruses in fungi.