Introduction

Vector-transmitted diseases such as avian malaria (Plasmodium spp.) might play an important role in adaptation and natural selection in bird populations (Atkinson et al. 2013). These parasites are widespread and highly prevalent among birds and can have a significant influence on host wellness and survival (Valkiūnas 2005). Although insect vectors play a key role in avian malaria transmission and dynamics, they are often neglected in ecological studies and in analyses of host-parasite interactions (Martínez-de la Puente et al. 2018, 2020).

The species of the genus Plasmodium are transmitted by vectors of the family Culicidae (Diptera), in which sexual process and sporogony take place (Santiago-Alarcon et al. 2012). Successful development of sporozoites in the blood-feeding insects is an obligatory criterion to recognize a certain insect species as a competent vector of a certain parasite species (Valkiūnas et al. 2013). Recently, many surveys are based mostly on molecular detection of parasite DNA in mosquitos’ whole body, abdomen (filled/not filled with blood) and head and thorax (Zélé et al. 2014; Martínez-de la Puente et al. 2015; Schoener et al. 2017; Guimarães et al. 2021). Though these studies involve molecular identification of the blood source and comparison of the parasite lineages found in particular host species, they mostly draw conclusions about “potential vectors” (Schoener et al. 2017; Guimarães et al. 2021). The currently used PCR-based methods cannot distinguish between different stages of parasite development in mosquitoes and would score as positive both presence of gametocytes, (or gametes, ookinetes, and oocysts) and presence of sporozoites. A combination of microscopic examination of salivary glands for sporozoites and PCR approach for identification of parasite lineages is essential in order to reveal competent vectors (Kim and Tsuda 2015). There are few experimental studies documenting the development of parasite and proving complete sporogony in a vector species (Kazlauskienė et al. 2013; Valkiūnas et al. 2015; Gutiérrez-López et al. 2016).

In the present study, we investigated the ability of wild mosquitoes (Culex spp.) to support complete sporogonic development of the widespread malaria parasite, Plasmodium relictum mitochondrial cytochrome b (cyt b) lineage SGS1, isolated from naturally infected great tits (Parus major).

Materials and methods

Insect collecting

Female mosquitoes were collected overnight in August 2017 at Kalimok Biological Station, northeast Bulgaria (44.01142° N, 26.43965° E) in two types of habitats: planted deciduous forest and reedbeds. We used All Weather EVS-CO2 Mosquito Trap (BioQuip Products, Inc.) with compressed bottle CO2, adjusting the CO2 volume with CO2 upgrade set (Biogents AG) to 0.5 kg per day. In the morning, the collected mosquitoes were moved to an insectarium and kept there for 2–3 days until the start of the experiments (t = 23–25 °C, humidity over 60%, 12-h light-and-dark cycle).

Experimental setup and insect dissection

A set of 50 female mosquitoes was allowed to feed for 3 h at night on a single great tit infected with P. relictum, cyt b lineage SGS1. This trial was repeated on a total of 6 birds infected with P. relictum. Two blood smears and one blood sample in SET buffer (0.05 M tris, 0.15 M NaCl, 0.5 M EDTA, pH 8.0) were collected after the puncture of the brachial vein of the birds. Parasitaemia and gametocytaemia of the infected birds were estimated as percent of the infected erythrocytes (actual count of 10,000 erythrocytes when parasitemia is < 0.1% and 1000 erythrocytes when parasitemia is > 0.1%) on Giemsa-stained thin blood films.

Birds were placed in individual cages (size 60 cm × 60 cm × 80 cm) in complete darkness and mosquitoes were released with a remote pneumatic system into the cage after the birds had calmed down and had become still on the perches. Three hours after the onset of the trial, the great tits were caught and removed from the cages, still in the dark. The survived mosquitoes were collected the next morning with an insect aspirator to examine the development of the parasitic stages in their organs. The bloodfed mosquitoes (n = 68) were dissected either within 1–2 days post-infection (dpi) for examination of development of ookinets (n = 10) or within 10–33 dpi for detection of oocysts and sporozoites (n = 58). Prior to dissection, the mosquitoes were anesthetized with a cotton pad soaked with 95% ethanol. Afterwards, each mosquito was placed on a clean glass slide under a stereo microscope (Ceti Steddy-BR). Dissection started by removing the legs and wings of the mosquito and storing them in a tube with 99% ethanol. A sterile syringe needle, pincers, and an entomological needle were used to extract the midgut and salivary glands in a drop of saline. The preparations for ookinete and sporozoite examination were made in a drop of saline on a glass slide, air-dried, fixed in absolute methanol, and stained in 10% Giemsa solution for 1 h. Temporary preparations for oocysts were prepared in a drop of saline, covered with coverslip, and stained with 2% mercurochrome solution. All the mosquito remains were placed in a tube with 99% ethanol for molecular identification of parasite lineages and insect species. All preparations were examined under light microscopes (Ceti Magnum Binocular Compound and Zeiss Axio Imager M2) with 400 × and 1000 × magnification.

Molecular identification of mosquito species

Mosquitoes that had sporozoites in the salivary glands were identified molecularly. Total DNA was extracted from the mosquito remains via PureLink™ Genomic DNA Mini Kit (Invitrogen™), following the manufacturer’s instructions. Universal primer pair LCO1490 and HCO 2198 (Folmer et al. 1994) was used to amplify a 658 bp fragment of insect mitochondrial COI gene in the following temperature regime: 1 min at 94 °C; five cycles of 1 min at 94 °C, 1.5 min at 45 °C and 1.5 min at 72 °C; 35 cycles of 1 min at 94 °C, 1.5 min at 50 °C and 1 min at 72 °C and a final cycle of 5 min at 72 °C (Hebert et al. 2003). PCR reaction was performed by using Thermo Scientific DreamTaq PCR Master Mix (2×) (Thermo Fisher Scientific Inc). All amplified fragments were sequenced on both strands at Macrogen Ltd. (Amsterdam, the Netherlands). Obtained sequences were edited, assembled, and aligned using CodonCode Aligner version 8.0.2 (CodonCode, Dedham, MA, USA) and compared to the available sequences in the GenBank DNA database.

Molecular identification of Plasmodium spp.

Genomic DNA was used for the amplification of 479 bp fragment of mitochondrial cyt b gene of the haemosporidian parasites as described by Hellgren et al. (2004). The reaction was carried out using Thermo Scientific DreamTaq PCR Master Mix (2×) (Thermo Fisher Scientific Inc). Presence of amplicons was visualized on 2% agarose gel stained with GelRed (Biotium Inc.). All samples positive for parasites were sequenced at Macrogen Ltd. (Amsterdam, the Netherlands) from the 5′ end with the primer HaemF (ATGGTGCTTTCGATATATGCATG). Obtained sequences were edited, assembled, and aligned using CodonCode Aligner version 8.0.2 (CodonCode, Dedham, MA, USA) and compared to the available sequences in the MalAvi database (Bensch et al. 2009).

Results and discussion

Out of the 68 dissected mosquitoes, 29 were confirmed to have a complete sporogony of P. relictum (cyt b lineage SGS1) by detecting sporozoites in the salivary glands (Fig. 1C–F) and by PCR amplification and sequencing parasite DNA. Of the 29 mosquitoes, 27 were molecularly identified as Culex pipiens and 2 as Culex modestus. The morphological features and size of the sporozoites were similar in C. pipiens (Fig. 1C, D) and in C. modestus (Fig. 1E, F). On the day of exposure, parasitemia of the donors (great tits) varied between 0.01 and 22.00%. The range of gametocytaemia was between 0.01 and 0.90%. Ookinetes were observed in 24 hrs post infection in two out of ten dissected mosquitoes (Fig. 1A). Oocysts were observed within 11–33 days post infection (dpi) with mean abundance 5.5 (0–46, n = 37) (Fig. 1B). A positive correlation between parasitaemia and the number of oocysts was found (Spearman rank order correlation rs = 0.6, p = 0.00007, n = 37). Accordingly, parasitemia have been considered as good predictor for oocyst burden in C. pipiens (Pigeault et al. 2015).

Fig. 1
figure 1

Ookinete (A), oocyst (B), and sporozoites (C–F) of Plasmodium relictum, cyt b lineage SGS1 developed in Culex pipiens (A–D) and Culex modestus (E, F)

Full size image

Culex pipiens is the most abundant ornithophilic mosquito at the study site and is likely to play a significant role in spreading avian malaria among birds in the area (Bobeva et al. unpubl.). The less common C. modestus was found for the first time to be a competent vector of P. relictum, which was able to complete sporogony and to develop sporozoites in this mosquito species. A survey of avian malaria in Culex mosquitoes in south Spain showed the presence of P. relictum lineage SGS1 in C. modestus head and thorax (Ferraguti et al. 2013) but did not confirm sporozoite development.

Culex modestus has a patchy distribution and is mostly found in central and southern Europe (Fig. 2). It seems that C. modestus prefers less urbanized wetland areas (Ferraguti et al. 2016). Similarly, this species was mostly caught in wetland reedbeds at Kalimok Station. Culex modestus has been studied as main competent vector for West Nile virus in France (Balenghien et al. 2007). From the present results, this mosquito might as well participate in spreading avian malaria, more specifically P. relictum SGS1 lineage, among birds inhabiting mesic habitats. Its significance as a vector of avian malaria remains to be assessed by collecting further data of its seasonal abundance as well as host and habitat preference.

Fig. 2
figure 2

Distribution of Culex modestus in Europe and North Africa. European Centre for Disease Prevention and Control and European Food Safety Authority. Mosquito maps [internet]. Stockholm: ECDC; 2021. Available from: https://ecdc.europa.eu/en/disease-vectors/surveillance-and-disease-data/mosquito-maps

Full size image

Our study also confirms the complete sporogony of P. relictum (cyt b lineage SGS1) in C. pipiens, as revealed in previous studies (Kazlauskienė et al. 2013). Plasmodium relictum (lineage SGS1) is a globally spread host-generalist parasite found in 139 bird species of 11 orders inhabiting Eurasia, Africa, North and South America, and Oceania (Bensch et al. 2009). Our findings bring new knowledge about the vector species responsible for the transmission of this most prevalent and widespread avian malaria parasite.