Introduction

P. heterophylla is a member of the Caryophyllaceae family and has been utilized as a traditional herbal medicine and therapeutic agent in China for more than two centuries. Its cultivation is primarily concentrated within a geo-authentic production zone spanning the provinces of Guizhou, Anhui, Shandong, and Fujian [1]. The annual production and value of P. heterophylla are estimated to be 8000 tons and 1 billion yuan, respectively. The herb has been extensively employed for the treatment of various ailments, including lung and spleen tonic [2], and has been reported to possess invigorating spleen, replenishing qi, moistening lung, and benefiting blood effects [3]. However, the cultivation of P. heterophylla is often impeded by continuous monoculture, which results in a high incidence of soil-borne diseases. Between 2015 and 2020, the disease incidence of P. heterophylla was reported to range from 12 to 78%, leading to a yield reduction of 15% to 60%.

The foliar disease is the principal complex disease affecting P. heterophylla, leading to a significant reduction in yield and quality and a serious destruction of the photosynthesis. The disease and its pathogens exhibit a high degree of diversity, as evidenced by various studies. Southern wilt, leaf blight, brown leaf spot, and black leaf spot are among the foliar diseases reported [4, 5]. Initial investigations have identified Sclerotium rolfsii, Ascochyta versabilis, Arcopilus aureus, and Alteraria tenuissima as the primary pathogens associated with foliar diseases [4,5,6,7]. Nonetheless, these investigations solely examine a solitary pathogen, and the occurrence of co-infection with multiple pathogens has yet to be documented.

Resistance-related genes play a crucial role in plant immunity against pathogen infection and environmental stresses. Accumulation of resistance-related genes has been observed in various plant species, including Lupinus albus, Arabidopsis thaliana, legumes, tobacco, wheat, and rice, when they are infected with Colletotrichum gloeosporioides [8], Fusarium oxysporum [9], Rhizoctonia solani [10], F. graminearum [11, 12], and Xanthomonas oryzae [13], respectively. Nonetheless, the manner in which resistance-related genes are expressed in P. heterophylla following pathogen infection remains unreported. Moreover, there has been insufficient analysis of the expression disparity in P. heterophylla when infected by distinct fungi.

This study aims to investigate the foliar disease samples of P. heterophylla in two distinct geo-cultivated areas of Guizhou province. The possible pathogens causing foliar diseases were systematically analyzed, and the response of P. heterophylla to isolated fungus was explored by determining 22 resistance-related genes expression patterns. The relationship between the expression of resistance-related genes and the pathogenicity of the isolated fungus was also analyzed. The findings of this study provide a theoretical foundation for the diagnosis and prevention of foliar diseases in P. heterophylla, as well as exploration of the resistance-related genes present in P. heterophylla has the potential to establish a fundamental basis for devising effective management tactics and furnish novel resources for the purpose of breeding disease-resistant P. heterophylla.

Materials and Methods

Sampling

In accordance with the guidelines established by the World Health Organization (WHO) regarding good agricultural and collection practices (GACP) for medicinal plants, the collection of diseased P. heterophylla plants (family Caryophyllaceae) occurred on April 13th, 2019 from two cultivation fields located in Huangping (N27° 4′ 21′′, E108° 8′ 0′′) and Majiang County (N26° 29′ 28′′, E107° 35′ 22′′), Guizhou province. The samples were promptly placed in sterile ice bags and expeditiously transported to a laboratory storage facility at a temperature of − 80 °C within 8 h.

Isolation of Fungi

Fungi were isolated in accordance with the methodology described by Larran et al. [14]. The symptomatic area of the diseased plant’s leaves was collected and subjected to sterilization using 75% alcohol for 30 s and sodium hypochlorite for 90 s. The sterilized leaves were then placed on the surface of PDA plates (with each plate accommodating five pieces) supplemented with 50 mg mL−1 of streptomycin sulfate. Subsequently, the plates were incubated at 28 ℃ for a period of 3 to 5 days. Following the growth of the clones, they were selected and cultured thrice in a new PDA petri dish and stored at 4 ℃ in PDA slants.

18S rDNA Sequencing and Analysis

The genomic DNA of isolates was extracted according to [15]. The fragment of 18S rDNA was amplified by the primers of NS1 (GTAGTCATATGCTTGTCTC) and NS8 (TCCGCAGCTTCACCTACGGA) [16]. The reaction system of PCR is as follows: 1 × EasyTaq Buffer, 2.5 U EasyTaq DNA Polymerase, 0.2-mM dNTPs (TransGen Biotech, AP111, China), 0.2 µM of each primer, and nearly 50 ng of the extracted genomic DNA. The protocol of PCR was performed in a DNA Engine Thermal Cycler (BIO-RAD, C1000 Touch, USA) with 95 ℃ for 5 min, followed by 35 cycles of denaturation 95 ℃ for 30 s, annealing 58 ℃ for 30 s, and extension 72 ℃ for 1 min, followed by final extension performed at 72 ℃ for 5 min. The target products among 1500 bp to 1900 bp were sequenced on Sangon Biotech (Shanghai, China).

The 18S rDNA sequences of the isolates were subjected to blast against the NR database using the BLASTn software. A phylogenetic analysis was then conducted using the Maximum Likelihood method in MEGA 7.0 software, and the confidence of the results was assessed through bootstrap analysis performed 1000 times.

Microscopic Observation of Spores and Hyphae of Isolated Fungi

Observation of mycelia and spores was conducted as follows: The isolates were cultured in a PDA medium at a temperature of 25 ℃ for a period of 5 days, after which the mycelia were observed under the Olympus BX41 microscope. Subsequently, the isolates were cultured in either PDA or OA medium at a temperature of 25 ℃ for a duration of 15 days, and the spores were then observed under the Olympus BX41 microscope.

Pathogenicity Test

The seedlings of P. heterophylla were procured through a series of steps. Firstly, the seeds of P. heterophylla were soaked in water overnight, followed by sterilization with 75% ethanol for 2 min and 10% sodium hypochlorite for 3 min. Subsequently, the seeds were washed thrice with ddH2O. The embryos were then carefully selected and cultured in MS medium for a period of 21 days. Finally, four-leaf seedlings were chosen for the pathogenicity test and virulence assay.

The pathogenicity test was conducted by means of a single leaf needle-stabbed injection technique using P. heterophylla cultivar Guishen 1# as previously described in Yuan et al. [5]. A 2-mm diameter mycelium block of fungal isolates was inoculated onto needle-stabbed leaves, with 16 seedlings being inoculated for each strain, while ddH2O was used as a control. The disease progression was observed every day. The fungi were isolated from the diseased tissues of the treatment group again by the plant tissue separation method and then purified and cultured. According to the morphology and culture characteristics of identification, DNA was extracted again simultaneously. The PCR amplification and the above operations were carried out to complete Koch’s rule.

Comparison of the Virulence of Nine Species Fungus to P. heterophylla

Virulence assays of the nine fungal species were performed single leaf needle-stabbed injection with P. heterophylla cultivar Guishen 1# as previously described [5]. For each species, a total of sixty-four leaves were inoculated and the number of leaves exhibiting disease symptoms and lesion sizes were recorded ten-day post-inoculation (dpi). The determination and calculation of the disease index (DI) followed the methodology outlined by Cooke et al. [17] and Ogata-Gutiérrez et al. [18]. The severity of leaf spot lesions was graded on a scale of five, where 0 indicated no lesions, 1 indicated 1–25% of infected leaves, 2 indicated 26–50% of infected leaves, 3 indicated 51–75% of infected leaves, and 4 indicated 76–100% of infected leaves. The DI was calculated using the following formula:

$${\text{Disease}}\,{\text{index }}\left( {{\text{DI}}} \right)\, = \,\frac{{{\text{Sum}}\,{\text{of}}\,{\text{all}}\,{\text{numerical}}\,{\text{grade}}}}{{{\text{Total}}\,{\text{number}}\,{\text{of}}\,{\text{ leaves}}\,{\text{counted }}\, \times \,{\text{Maximum}}\,{\text{grade}}}}\, \times \,100.$$

The DI method, as modified by Omar et al. [19], was employed to classify the virulence severity of nine fungal species. The classification was based on four categories: avirulence (DS < 0.2), low virulence (0.2 ≤ DS < 2), moderate virulence (2 ≤ DS < 3), and high virulence (DS ≥ 3).

The Retrieval of Resistance-Related Genes in P. heterophylla from Transcriptome

The transcriptome data of P. heterophylla, available in NCBI (SAR: SRX847831), was utilized for functional annotation in conjunction with the NCBI non-redundant database. Subsequently, the resistance-related genes associated with “disease resistance” was extracted from the annotated transcriptome. The main function domain of the retrieved genes was analyzed using TBtools software V1.075 (Guangzhou, China) [20] to predict the type of resistance-related genes.

The Expression of Resistance-Related Genes in P. heterophylla Inoculated with Pathogens by qRT-PCR

The primers utilized for qRT-PCR of resistance-related genes were designed via Premier 5.0 software (Table S1). The resistance-related genes primers were subsequently verified through the utilization of normal PCR, employing the following methodology. The PCR system consisted of 2.5 μL of 10 × Easy Taq Buffer, 2 μL of 2.5-mM dNTPs, 0.5 μL of Easy Taq Polymerase, 2.5 μM of each primer, 2 μL of cDNA, and the addition of ddH2O to a final volume of 25 μL. The protocol of PCR was performed in a DNA Engine Thermal Cycler (BIO-RAD, C1000 Touch, USA) with pre-denaturation at 95 ℃ for 5 min, followed by 35 cycles of denaturation at 95 ℃ for 30 s, annealing at 60 ℃ for 30 s, and extension at 72 ℃ for 30 s, followed by final extension performed at 72 ℃ for 5 min. The amplicons were detected by 2% agarose gel electrophoresis.

Following a ten-day injection period, leaf samples were collected as previously described. Total RNA was extracted and cDNA was synthesized using the Promage RNA extraction kit protocol. qPCR was performed using the PowerUPTM SYBRTM Green Master Mix kit instructions. The qPCR system consisted of 10 μL of SYBRTM Green Master Mix, 1 μL of cDNA, and ddH2O added to a final volume of 20 μL. The PCR protocol was executed using a DNA Engine Thermal Cycler (BIO-RAD, CFX96 Touch, USA) and involved a thermal cycling program consisting of pre-denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 20 s, and extension at 72 °C for 20 s. The plate read was conducted at 72 °C for 30 s. To assess the specificity of each PCR primer pair, a melting curve analysis was performed by subjecting the reaction to incubation at 95 °C for 20 s, cooling to 55 °C for 10 s, and increasing to 95 °C at a rate of 0.5 °C per 10 s. The relative expression of the gene was determined using the following formula: The relative expression = log2 − (CTtarget gene − CTPhActin1).

The Relationship Between DI of Fungus and the Expression of Resistance-Related Genes in P. heterophylla Infected with Fungus

P. heterophylla leaves with diverse levels of disease severity were selected for qRT-PCR analysis to investigate the expression of resistance-related genes. Following this, a correlation analysis between the expression levels of resistance-related genes and the disease index (DI) was conducted using the Spearman method in GraphPad Prism V9 (CA, USA). The correlation coefficient was visualized through a heatmap generated by TBtools software V1.075 (Guangzhou, China).

Statistical Analyses

Origin software (version 9.0) analyzed significant differences using the analysis of variance (ANOVA) and the LSD multiple range test.

Results

Isolation and Identification of Fungus from Diseased P. heterophylla Leaves

A total of 22 isolates were obtained, with eight isolates and 14 isolates originating from Majang County and Huangping County, respectively, as indicated in Table 1. The 18S rDNA sequence and phylogenetic analysis revealed that these isolates belonged to nine distinct species, namely Alternaria alternata (1 isolate), Arcopilus aureus (1 isolate), Botrytis cinerea (2 isolates), Cladosporium cladosporioides (2 isolates), Coprinellus xanthothrix (2 isolates), F. oxysporum (4 isolates), Whalleya microplaca (5 isolates), Nemania diffusa (4 isolates), and Schizophyllum commune (1 isolate) (Fig. 1, Table S2).

Table 1 The statistics of isolated fungi
Full size table
Fig. 1
figure 1

The characteristics of hyphae and spores of isolates. The scale represents 10 μm

Full size image

To further confirm the identification results, mycelia and spores of the nine species of fungus were observed (Fig. 2). The colony of isolates MJ2-2a are flocculent and grow rapidly on PDA. It is gray early, dark after old age, and brown on the back. Hyphae and conidia brownish green, septate. Conidia inverted rod shape, surface with transverse and mediastinum, brick wall structure, and the transverse septum is thick, most of 3, the end of the short beak, arranged in a long straight or oblique chain; brown–green, uniform in size, about 35–42 μm × 6–20 μm. These characteristics are very similar to the description of A. alternata by Abbas et al. [21].

Fig. 2
figure 2

Phylogeny analysis of isolates using 18S rDNA sequence based on Maximum likelihood method using MEGA 7.0 software, with confidence tested by bootstrap analysis with 1000 times

Full size image

The colony of isolates MJ2-2b are dense and grow slowly on PDA. It is yellowish brown and secreted brownish red pigment, and it has no conidia growing on PDA. Ascospores, when mature, were grayish white to gray, limoniform, or fusiform to pyriform. These characteristics are similar to the description of A. aureus by Yuan et al. [5].

The colony of isolates HP-2d and HP-2e is sparse and grows rapidly on PDA. In about ten days, gray sclerotia will form. Conidia stalk about 280–550 μm × 12–24 μm, caespitose, gray, later turning brown, and apex swollen or acute, with small projections. Conidia solitary on small protuberances; Conidia subglobose or ovate, 9–15 μm × 6.5–10 μm. These characteristics are similar to the description of B. cinerea in previous research [22].

The colony of isolates MJ2-1b, HP-3a, and HP-3b is dense and grows slowly on PDA. The young mycelium is yellow and old hyphae turn dark green on PDA. Conidia stalk Lateral growth on mycelia, unbranched, not constricted at sections, erect, no longer extended after sporulation, not dilated, smooth or verrucous, pale brown, and 90–350 μm × 2.7–5.5 μm. Conidia terminal or lateral forms branched spores, elliptic, cylindrical, lemon-shaped, subglobose, pale brown, smooth, 0–1 septum, most without septum, and 3.2–14.8 μm × 2.7–5.4 μm. These characteristics are very similar to the description of C. cladosporioides in Nam et al. [23] research.

The colony of isolates HP-2a, HP-2b, HP-2c, and HP-1a is raised, and flocculent and the mycelia were white and dense. Colonies are pinkish white, pale pink to fleshy, with purplish tinges, and silty due to abundant spore formation. The microconidia are born on the single bottle stem, often clustered into pellets, single cells, and ovate at the top of the bottle stem. The macroconidia about 3-septate are sickle shaped and slightly curved. The chlamydospores are apical or terminal, globose. These characteristics are very similar to the description of F. oxysporum in Rahmam et al. [24] research.

The colony of isolates WBH-a and WBH-b is dense and grows slowly on PDA. It is yellowish brown and secreted brownish red pigment, and it has no conidia growing on PDA. These characteristics are similar to the description of C. xanthothrix in Badalyan et al. [25] research.

The colony of isolates MJ-1a, MJ-2b, MJ-3a, and MJ-3b are dense and grow slowly on PDA. It is yellowish brown and secreted brownish red pigment, and it has no conidia growing on PDA. These characteristics are very similar to the description of N. diffusa in Pi et al. [26] research.

The colony of isolates HP-2CK-a are dense and grow slowly on PDA. It is yellowish brown and secreted brownish red pigment, and it has no conidia growing on PDA. These characteristics are very similar to the description of S. commune in Kamei et al. [27] research.

The colony of isolates MJ-2a, WBH-e, WBH-c, and WBH-d are dense and grow slowly on PDA. It is yellowish brown and secreted brownish red pigment, and it has no conidia growing on PDA. These characteristics are very similar to the description of W. microplaca in He et al. [28] research.

Identification the Pathogenicity of Nine Isolated Species to P. heterophylla

To identify whether the nine isolated species are the pathogens of P. heterophylla, the pathogenicity test was conducted by a single leaf needle-stabbed injection method using P. heterophylla cultivar Guishen 1# as previously described by Yuan et al. [5]. After ten days treatment, the inoculated leaves with F. oxysporum (strains HP-2a, HP-2b, HP-2c, and HP-1a), A. alternata (strain MJ2-2a), B. cinerea (strains HP-2d and HP-2e), A. aureus (strain MJ2-2b), W. microplaca (strains MJ-2a, WBH-e, WBH-c, and WBH-d), N. diffusa (strains MJ-1a, MJ-2b, MJ-3a, and MJ-3b), and C. cladosporioides (strains MJ2-1b, HP-3a, and HP-3b) exhibited disease symptoms characterized by the appearance of black–yellow lesions and waterlogging of the whole leaf, of white lesions, of black–yellow lesions and wilting of the whole leaf, of white lesions and forming a black mold layer, of white lesions, of black–yellow lesions, and of yellow lesions and covering a black mold layer, respectively (Fig. 3). While the inoculated leaves with S. commune (strain HP-2CK-a), C. xanthothrix (strains WBH-a and WBH-b), and ddH2O remained asymptomatic throughout the experiment (Fig. 3). The fungal pathogens were re-isolated from the inoculated leaves, thus fulfilling Koch’s postulates. The findings showed that F. oxysporum, A. alternata, B. cinerea, A. aureus, W. microplaca, N. diffusa, and C. cladosporioides are the foliar pathogens of P. heterophylla, while S. commune and C. xanthothrix are not the foliar pathogens of P. heterophylla.

Fig. 3
figure 3

Identification the pathogenicity of nine isolated species to P. heterophylla

Full size image

Comparison of the Virulence of Nine Species Fungus to P. heterophylla

The virulence assay found that the DI of P. heterophylla in response to F. oxysporum, A. alternata, B. cinerea, A. aureus, N. diffusa, W. microplaca, and C. cladosporioides to P. heterophylla was 3.45 ± 0.15, 2.70 ± 0.24, 2.35 ± 0.25, 2.05 ± 0.17, 1.70 ± 0.23, 1.55 ± 0.14, and 0.95 ± 0.14, respectively. Conversely, the DI of P. heterophylla in response to C. xanthothrix and S. commune was 0.10 ± 0.14 (Table 2, Fig. 4). In accordance with the guidance of Cooke et al. [17] and Ogata-Gutiérrez et al. [18], F. oxysporum were classified as a high virulence pathogen, A. alternata, B. cinerea, and A. aureus were identified as moderate virulence pathogens, while N. diffusa, W. microplaca, and C. cladosporioides were proved to low virulence fungus (Table 2).

Table 2 The virulence of isolated species to P. heterophylla
Full size table
Fig. 4
figure 4

Symptom of P. heterophylla seedlings after inoculating isolates. The scale represents 0.5 cm

Full size image

The Expression Pattern of Resistance-Related Genes with High Diversity and Specificity Response to Isolated Fungus in P. heterophylla

Twenty-two resistance-related genes were obtained from transcriptome data of P. heterophylla and subsequent phylogenetic analysis using TBtools software revealed their division into seven clades (Fig. 5). Clades I–VII contained three (PhBDRN6, PhBDRN7, and PhBDRN8), two (PhBDRN10 and PhBDRN12), two (PhBDRN9 and PhBDRN18), four (PhBDRN16, PhPRP1, PhBDRN2, and PhBDRN5), one (BDRN15), eight (PhDR1, PhBDRN14, PhPEDR, PhBDRN1, PhBDRN3, PhBDRN4, PhBDRN13, and PhBDRN17), and two (PhDRP1 and PhBDRN11) resistance-related genes, respectively. The analysis of conserved domains revealed that a total of thirteen resistance-related genes (PhBDRN7, PhBDRN6, PhDR1, PhBDRN12, PhBDRN15, PhBDRN17, PhBDRN5, PhBDRN14, PhBDRN13, PhBDRN11, PhBDRN10, PhDRP1, and PhBDRN8), nine resistance-related genes (PhBDRN7, PhBDRN6, PhDR1, PhBDRN12, PhBDRN15, PhBDRN17, PhBDRN5, PhBDRN14, and PhBDRN13), six resistance-related genes (PhBDRN7, PhBDRN6, PhDR1, PhBDRN12, PhBDRN11, and PhBDRN4), nine resistance-related genes (PhBDRN7, PhBDRN6, PhBDRN15, PhBDRN17, PhBDRN10, PhBDRN9, PhBDRN3, PhBDRN1, and PhBDRN16), one resistance-related gene (PhPEDR), one resistance-related gene (PhBDRN9), one resistance-related gene (PhBDRN3), and one resistance-related gene (PhPRP1) contain the NB-ARC, RX, LRR, PLN03210, PLN00188, PLN00113, PLN03150, and Barwin domains, respectively (Fig. 5). These results show that the 22 genes belong to resistance-related genes.

Fig. 5
figure 5

The phylogeny analysis of resistance-related genes in P. heterophylla

Full size image

The qRT-PCR analysis found that ten, two, three, four, seven, thirteen, five, one, and six resistance-related genes were upregulated by F. oxysporum, A. alternata, B. cinerea, A. aureus, N. diffusa, W. microplaca, C. cladosporioides, S. commune, and C. xanthothrix, respectively (Fig. 6). And four, five, one, one, two, one, two, six, and one resistance-related genes were downregulated by F. oxysporum, A. alternata, B. cinerea, A. aureus, N. diffusa, W. microplaca, C. cladosporioides, S. commune, and C. xanthothrix, respectively (Fig. 6). The findings of this study suggest that the resistance-related genes of P. heterophylla exhibit inducibility in response to diverse fungal stimuli, with notable variations in both the quantity and magnitude of resistance-related gene induction across different fungal species. Furthermore, the same resistance-related genes were found to be involved in the response to multiple fungal stimuli, with PhPRP1, PhBDRN15, PhBDRN11, and PhBDRN3 being upregulated by nine, five, four, and four fungal species, respectively. The findings indicate that the genes PhPRP1, PhBDRN15, PhBDRN11, and PhBDRN3 may play a role in the resistance response to a range of fungal pathogens. Conversely, the genes PhBDRN5, PhBDRN1, PhBDRN14, and PhBDRN2 were observed to be downregulated by nine, five, three, and three fungi, respectively, suggesting their involvement in the susceptible response to fungal infections.

Fig. 6
figure 6

Resistance-related genes response to isolated fungus in P. heterophylla

Full size image

The Relationship Between DI of Fungus and the Expression of Resistance-Related Genes in P. heterophylla Infected with Fungus

The results of the correlation analysis revealed a positive correlation between the expression of PhPRP1 and PhBDRN15 and the DI of B. cinerea, W. microplaca, N. diffusa, F. oxysporum, A. aureus, A. alternata, and C. cladosporioides in P. heterophylla (Fig. 7). The finding suggests that these two resistance-related genes may play a crucial role in conferring broad-spectrum resistance against the aforementioned pathogens. The negative correlation between the expression of PhBDRN1 and PhBDRN5 genes and the DI of B. cinerea, W. microplaca, N. diffusa, F. oxysporum, A. aureus, A. alternata, and C. cladosporioides in P. heterophylla suggests that these two genes play a role in the broad-spectrum susceptible reaction to these seven pathogens.

Fig. 7
figure 7

The relationship between DI of fungus and the expression of resistance-related genes in P. heterophylla infected with fungus. The color red denotes a positive correlation; while blue indicates a negative correlation. Additionally, the intensity of the color corresponds to the strength of the correlation. The symbols *, **, and *** signify a statistically significant correlation when the P-value is less than 0.05, 0.01, and 0.005, respectively

Full size image

Moreover, our investigation revealed a positive association between the expression of seven resistance-related genes (BDRN15, BDRN7, DRP1, BDRN18, BDRN11, BDRN12, and BDRN8) and the DI of non-pathogenic C. xanthothrix, while no resistance-related genes exhibited a negative correlation. Furthermore, the number of resistance-related genes exhibiting a positive correlation with DI was greater for low virulence pathogens W. microplaca and N. diffusa (17 and 12, respectively) compared to the number of resistance-related genes exhibiting a negative correlation (2 and 3, respectively). Conversely, the number of resistance-related genes exhibiting a positive correlation with DI was fewer (2 genes) than the number of resistance-related genes exhibiting a negative correlation (13 genes) for medium virulence pathogen A. alternata. The findings suggest that the heightened virulence of the pathogen was linked to a reduction in the number of upregulated resistance-related genes and an increase in the number of downregulated resistance-related genes. Despite the fact that the number of resistance-related genes exhibiting a positive correlation (10 genes) exceeded that of those exhibiting a negative correlation (4 genes) with the DI of the highly virulent pathogen F. oxysporum, the strength of the positive correlation was lower than that of the negative correlation. These results indicate that the intensity and quantity of induced R genes may jointly influence the resistance of P. heterophylla to pathogens.

Discussion

The foliar fungal diseases of P. heterophylla have a significant impact on its growth and yield, resulting in substantial economic losses. Therefore, the identification and isolation of the pathogens responsible for these diseases are crucial for targeted disease control. In this study, nine species, including F. oxysporum, A. alternata, B. cinerea, A. aureus, N. diffusa, S. commune, C. cladosporioides, and C. xanthothrix, were isolated and identified from the foliar diseases of P. heterophylla. Pathogenicity assays revealed that these nine species were capable of causing the foliar disease of P. heterophylla. It has been reported that F. oxysporum, A. alternata, B. cinerea, A. aureus, N. diffusa, and C. cladosporioides are pathogens of cucumber [29], onion [30], millet [31], eggplant [32], P. heterophylla [5], tomato [33], cardamom [34], peach [35], Calliandra haematocephala [36], strawberry [23], and Torreya taxifolia [37]. The findings suggest that P. heterophylla may be susceptible to foliar pathogens, such as F. oxysporum, A. alternata, B. cinerea, A. aureus, N. diffusa, and C. cladosporioides. Notably, this study reports for the first time that F. oxysporum, A. alternata, B. cinerea, N. diffusa, and C. cladosporioides are potential pathogens of foliar diseases in P. heterophylla, in addition to A. aureus.

Numerous reports indicate that plant diseases, particularly those caused by viruses, are commonly the result of co-infected intraspecies pathogens [38,39,40,41]. Barrett et al. [42] demonstrated that wheat smut arises from mixed infections of distinct genotype strains of Zymoseptoria tritici. Such mixed infections are likely to have a substantial impact on the emergence of septoria tritici blotch epidemics and the evolution of virulence in Z. tritici. Additionally, the pathogenicity assay revealed that multiple isolated pathogens exhibit comparable symptoms under natural circumstances. Our study reveals that our isolated nine species exhibit comparable symptoms (Fig. 3). This implies that controlling foliar diseases in P. heterophylla cannot be achieved through fungicides that target specific pathogens, but rather through the use of broad-spectrum fungicides.

The presence of a wide range of virulence genes (inducers) in various pathogens results in varying levels of host resistance to different pathogens, which is attributed to the unique ability of the matching between inducers and resistance-related genes [43]. Extensive research has demonstrated that the interaction between inducer and resistance-related gene can either induce disease resistance and enhance pathogen inhibition or cause a susceptible response and promote pathogen invasion. Our investigation revealed significant variations in the pathogenicity of P. heterophylla among seven pathogens (Table 2). The positive correlation between the number of resistance-related genes and the DI was found to be associated with the disease resistance of P. heterophylla (Fig. 6). These findings suggest that the compatibility between the resistance-related genes of P. heterophylla and the inducers of the pathogens may serve as a prerequisite for inducing resistance to diverse pathogens in P. heterophylla. However, further investigation is required to illustrate the specific and shared interactions between the resistance-related genes of P. heterophylla and the inducers of various pathogens.

The identification and utilization of disease resistance genes are essential genetic resources for plant disease resistance breeding. Therefore, the exploration of resistance genes holds significant importance for molecular disease resistance breeding of P. heterophylla. Our investigation revealed that PhPRP1 and PhBDRN15 exhibit broad-spectrum resistance to pathogens (Figs. 6, 7). Numerous studies have demonstrated that the overexpression of resistance genes can enhance resistance to pathogens [13, 44]. For example, Kesarwani et al. reported that the overexpression of resistance-related genes TGA1 and TGA4 significantly improved resistance to Xanthomonas in arabidopsis. The result suggests that PhPRP1 and PhBDRN15 possess potential utility in the genetic enhancement of P. heterophylla for broad-spectrum disease resistance breeding. Additionally, the susceptibility genes, such as PhBDRN1 and PhBDRN5, can be utilized for resistance breeding through gene silencing or knockout. Our investigation revealed that these genes exhibit a broad-spectrum susceptibility to pathogens. Numerous studies have been conducted to enhance resistance to pathogens through knockout techniques. For instance, the susceptible gene TaMLO in wheat was rewritten, resulting in the development of a mutant cultivar with complete resistance to powdery mildew and improved wheat yield [45]. Henceforth, the overexpression of resistance genes (PhPRP1 and PhBDRN15) and the knockout of susceptible genes (PhBDRN1 and PhBDRN5) may be employed to attain comprehensive disease resistance breeding of P. heterophylla in the forthcoming times.

The pathogenicity assay and the qRT-PCR analysis revealed that C. xanthothrix, an avirulence fungi to P. heterophylla, significantly upregulated six out of 22 resistance-related genes. These results suggest that C. xanthothrix has the potential to enhance the disease resistance of P. heterophylla by priming a broad spectrum of resistance reactions. It is plausible that C. xanthothrix possesses numerous pathogen-associated molecular patterns (PAMPs), such as polysaccharides, on its cell surface, which may trigger a robust plant defense response by mimicking pathogenic agents. Numerous studies have demonstrated the efficacy of lentinan [46,47,48], chitosan [49,50,51,52], and chitin [53,54,55] in managing plant diseases and enhancing disease resistance in various crops. These evidences suggest that PAMP molecules of C. xanthothrix can serve as effective inducers for the prevention and control of plant disease.

In conclusion, we first reported that F. oxysporum, A. alternata, B. cinerea, N. diffusa, S. commune, and C. cladosporioides were the pathogens of foliar diseases of P. heterophylla. Pathogenesis assay indicated that the foliar diseases of P. heterophylla could be co-infected by multiple pathogens. The qRT-PCR analysis revealed that R genes were generally upregulated by various fungi and were widely involved in the interaction between multiple fungi and P. heterophylla. And more, we found that PhPRP1, PhBDRN15, PhBDRN11, and PhBDRN3 genes had broad-spectrum resistance to various fungi. Furthermore, the C. xanthothrix, avirulence fungi to P. heterophylla, could prime a wide range of resistance reactions of P. heterophylla to enhance its disease resistance. This study provided insight into the management strategies of foliar diseases of P. heterophylla and new genetic materials for disease-resistant breeding.